Morad_Mokhtar

Enzyme Id: K13456         Number of primers: 4



Enzyme Id:  K13456   &  Pathway Id:  ko04626

Sequence Id v.faba_CSFL_reftransV2_0005207
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101493917        UniProtKB Protein Id: A0A1S3E0Y8
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CCTTGCGCACTTTGTCGAAA      Tm= 60      GC%= 50
Reverse Primer AGTACTGCTGGCTCGGAGTA      Tm= 60      GC%= 55
Product Size 590
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K13456   &  Pathway Id:  ko04626

Sequence Id v.faba_CSFL_reftransV2_0012783
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_8g012960        UniProtKB Protein Id: A0A072TXB9
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer GGAAAGGTCGAACTGGCTCA      Tm= 60      GC%= 55
Reverse Primer TTGCGGATAACATGTGGCCT      Tm= 60      GC%= 50
Product Size 643
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K13456   &  Pathway Id:  ko04626

Sequence Id v.faba_CSFL_reftransV2_0025706
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101494956        UniProtKB Protein Id: A0A1S2YUS7
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer TTGCGGATAACATGTGGCCT      Tm= 60      GC%= 50
Reverse Primer TAACCCTGCATCAGCTGAGC      Tm= 60      GC%= 55
Product Size 117
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K13456   &  Pathway Id:  ko04626

Sequence Id v.faba_CSFL_reftransV2_0025706
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101494956        UniProtKB Protein Id: A0A1S2YUS7
Marker Type Marker Type: EST-SSR
Repeat Type and Sequence Mono      (A)10
Forward Primer AACAGTAACGCCACGAAAGG      Tm= 59      GC%= 50
Reverse Primer TAACCCTGCATCAGCTGAGC      Tm= 60      GC%= 55
Product Size 410
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download