Morad_Mokhtar

Enzyme Id: K14292         Number of primers: 1



Enzyme Id:  K14292   &  Pathway Id:  ko03013

Sequence Id v.faba_CSFL_reftransV2_0019852
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_1g019290        UniProtKB Protein Id: G7I3J0
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer CCAGAGACACATTGGGCCAT      Tm= 60      GC%= 55
Reverse Primer AGCTATCCAGTCCCTCGGTT      Tm= 60      GC%= 55
Product Size 694
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download