Morad_Mokhtar

Enzyme Id: K14305         Number of primers: 1



Enzyme Id:  K14305   &  Pathway Id:  ko03013

Sequence Id v.faba_CSFL_reftransV2_0012346
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101496902        UniProtKB Protein Id: A0A1S2YP73
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer GATCCCACCATTGAAGCCCA      Tm= 60      GC%= 55
Reverse Primer GACTCCGATTCCGACGTCTC      Tm= 60      GC%= 60
Product Size 460
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download