Morad_Mokhtar

Enzyme Id: K14319         Number of primers: 2



Enzyme Id:  K14319   &  Pathway Id:  ko03013

Sequence Id v.faba_CSFL_reftransV2_0032515
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101502866        UniProtKB Protein Id: A0A1S3E2Y0
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer GACTAGGGCTGAAGCTGCAA      Tm= 60      GC%= 55
Reverse Primer TCCACAAGGATAGCCGAGGA      Tm= 60      GC%= 55
Product Size 908
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K14319   &  Pathway Id:  ko03013

Sequence Id v.faba_CSFL_reftransV2_0032515
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: LOC101502866        UniProtKB Protein Id: A0A1S3E2Y0
Marker Type Marker Type: EST-SSR
Repeat Type and Sequence Penta      (AAAAG)3
Forward Primer GACTAGGGCTGAAGCTGCAA      Tm= 60      GC%= 55
Reverse Primer AATAAGCAGTGACGGGGCTC      Tm= 60      GC%= 55
Product Size 477
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download