|
| Sequence Id | v.faba_CSFL_reftransV2_0024850 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_5g089510 UniProtKB Protein Id: A0A072UH06 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGCATCCACACCATTACCCC Tm= 60 GC%= 55 |
| Reverse Primer | TCGGAGTCTGGCAGTGGATA Tm= 60 GC%= 55 |
| Product Size | 980 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0014435 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g013980 UniProtKB Protein Id: A0A072VEE6 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | CCATTACCTTCTGCCCCGTT Tm= 60 GC%= 55 |
| Reverse Primer | CACCAAGAAAACCTGGCTGC Tm= 60 GC%= 55 |
| Product Size | 445 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0014679 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101504757 UniProtKB Protein Id: A0A1S2XLN3 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GAGGAAGCCCATTCTTGGCT Tm= 60 GC%= 55 |
| Reverse Primer | ATCTCCACCGATCCTCCACA Tm= 60 GC%= 55 |
| Product Size | 501 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
