Morad_Mokhtar

Enzyme Id: K14502         Number of primers: 2



Enzyme Id:  K14502   &  Pathway Id:  ko04075

Sequence Id v.faba_CSFL_reftransV2_0004292
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_2g083940        UniProtKB Protein Id: G7IM77
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer AGTTACATGGCCGAACGTGT      Tm= 60      GC%= 50
Reverse Primer CTCGGTACATCGTCTCAGGC      Tm= 60      GC%= 60
Product Size 259
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download


Enzyme Id:  K14502   &  Pathway Id:  ko04075

Sequence Id v.faba_CSFL_reftransV2_0026105
NCBI Gene & UniProtKB Protein Id NCBI Gene Acc: MTR_2g016490        UniProtKB Protein Id: I3SJN2
Marker Type Marker Type: EST
Repeat Type and Sequence -      -
Forward Primer AAAGGTGCTTGGAACACCCA      Tm= 60      GC%= 50
Reverse Primer ATAGCCGGGAAGCAAGATCG      Tm= 60      GC%= 55
Product Size 152
JBrowse View      JBrowse
Pathway Browse View      Pathway Browse
Corresponding Sequence

Download