|
| Sequence Id | v.faba_CSFL_reftransV2_0013533 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: KK1_024887 UniProtKB Protein Id: A0A151SEJ6 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TTCCATCCAGCACCGTAACC Tm= 60 GC%= 55 |
| Reverse Primer | CCCTCCGAGTTCGAATCGAG Tm= 60 GC%= 60 |
| Product Size | 592 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0031848 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101494121 UniProtKB Protein Id: A0A1S2YXU2 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TGGCACTCCCTCTACTCCTC Tm= 60 GC%= 60 |
| Reverse Primer | GGAGCCTTGGTAGCACCTTT Tm= 60 GC%= 55 |
| Product Size | 646 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
