|
| Sequence Id | v.faba_CSFL_reftransV2_0036046 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_8g028120 UniProtKB Protein Id: I3SHU4 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | ACGCATGCAGAAGATGGTCA Tm= 60 GC%= 50 |
| Reverse Primer | CGCGTTGACTGCAAGTTTCA Tm= 60 GC%= 50 |
| Product Size | 153 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0003061 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g099910 UniProtKB Protein Id: G7IUG9 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TCATCGTCTCCCATCTCCGT Tm= 60 GC%= 55 |
| Reverse Primer | CCACAAGCAACATCCATGGC Tm= 60 GC%= 55 |
| Product Size | 336 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
