|
| Sequence Id | v.faba_CSFL_reftransV2_0007817 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: PHAVU_002G312300g UniProtKB Protein Id: V7CQ46 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | AGGGGGCATGTAAAACTCGG Tm= 60 GC%= 55 |
| Reverse Primer | AGAGCGGAATGGCTTCGAAA Tm= 60 GC%= 50 |
| Product Size | 672 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0018951 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: MTR_2g101360 UniProtKB Protein Id: G7IUM8 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | TCGTGCAATGAGAAGCTCGT Tm= 60 GC%= 50 |
| Reverse Primer | AACTCCACGACTTGAGGCTG Tm= 60 GC%= 55 |
| Product Size | 543 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
|
| Sequence Id | v.faba_CSFL_reftransV2_0026657 |
| NCBI Gene & UniProtKB Protein Id | NCBI Gene Acc: LOC101488340 UniProtKB Protein Id: A0A1S2X9Q5 |
| Marker Type | Marker Type: EST |
| Repeat Type and Sequence | - - |
| Forward Primer | GCAGCAACAGACGAAGCAAA Tm= 60 GC%= 50 |
| Reverse Primer | AATGGAGGAGGTTGGCATGG Tm= 60 GC%= 55 |
| Product Size | 164 |
| JBrowse View | JBrowse |
| Pathway Browse View | Pathway Browse |
| Corresponding Sequence | Download |
